Read mapping ============ Map ^^^ Map single or paired-end short reads to one or multiple genomes in the pangenome. One SAM or BAM file is generated for each genome included in the analysis. **Parameters** .. list-table:: :widths: 30 70 * - - Path to the database root directory. * - - One or two short-read archives in FASTQ format, which can be gz/bz2 compressed. **Options** .. list-table:: :widths: 30 70 * - ``--threads``/``-t`` - Number of threads for MAFFT and IQ-tree, default is the number of cores or 8, whichever is lower. * - ``--output``/``-o`` - Path to the output files (default is the database path). * - ``--include``/``-i`` - Only include a selection of genomes. * - ``--exclude``/``-e`` - Exclude a selection of genomes. * - ``--best-hits`` - In case of multiple "best" hits, return **none**, **all** best hits or a **random** best hit (Default: random). * - ``--all-hits`` - Return all hits rather than only the best. * - ``--competitive`` - Find the best mapping location in the complete pangenome |br| (default: find the best location for each genome). * - ``--previous-run`` - The mapping_summary.txt file from a previous mapping run (random-best competitive mode) for a better estimation of coverage in a metagenomic setting. * - ``--out-format`` - Writes the alignment files in BAM or SAM format or don't write any output files (NONE) (default: SAM). * - ``--gap-open`` - Gap open penalty (range: [-50..-1], default: -20). * - ``--gap-extension`` - Gap extension penalty (range: [-5..-1], default: -3). * - ``--interleaved`` - Process the fastq file as an interleaved paired-end archive. * - ``--unmapped`` - Check unmapped genomes. **Options that influence the mapping sensitivity** .. list-table:: :widths: 30 70 * - ``--sensitivity``/``-s`` - Four settings that automatically set the parameters controlling the sensitivity, ranging from least to most sensitive (very-fast|fast|sensitive|very-sensitive). * - ``--min-identity`` - The minimum acceptable identity of the alignment |br| (default: 0.5, range: [0,1]). * - ``--alignment-band`` - The length of bound of banded alignment |br| (default: 5, range: [1..100]). * - ``--min-hit-length`` - The minimum acceptable length of alignment after soft-clipping |br| (default: 13, range: [10..100]). * - ``--max-num-locations`` - The maximum number of locations of candidate hits to examine |br| (default: 15, range: [1..100]). * - ``--max-alignment-length`` - The maximum acceptable length of alignment |br| (default: 2.000, range: [50..5.000]). * - ``--max-fragment-length`` - The maximum acceptable length of fragment |br| (default: 4998, range: [50..5000]). * - ``--num-kmer-samples`` - The number of kmers sampled from read |br| (default: 15, range: [1..r-k+1]). * - ``--clipping-stringency`` - The stringency of soft-clipping (default: 1). |br| 0 : no soft clipping |br| 1 : low |br| 2 : medium |br| 3 : high **Example input files** FASTQ file .. code:: text @SRR13153715.1 1/1 TGGTCATACAGCAAAGCATAATTGTCACCATTACTATGGCAATCAAGCCAGCTATAAAACCTAGCCAAATGTACCATGGCCATTTTATATACTGCTCATACTTTCCAAGTTCTTGGAGATCGAT + EEEEEEEEEEEEEEEAEEEE/EEEEE/AEEEEEEEEEEEEEE/EE/EEE/